Chat with us, powered by LiveChat BIO100Biology ConceptsLesson 6, Part 1 Quiz Question1 of 50Which of the followin | WriteMoh

BIO100Biology ConceptsLesson 6, Part 1 Quiz Question1 of 50Which of the followin

BIO100Biology ConceptsLesson 6, Part 1 Quiz Question1 of 50Which of the following characteristics may be present in living things, but is not adefining characteristic of living things?MovementEnergy utilizationResponse to the environmentReproductionGrowth Question2 of 50In reviewing the biological levels of life, which of the following is the broadest level andencompasses all of the life on Earth?CommunityPopulationOrganismEcosystemBiosphere Question3 of 50Place the following biological levels in order from smallest to largest level.Cells, tissues, organelles, organism, ecosystem, communityOrganelles, cells, tissues, organism, community, ecosystemOrganelles, organism, cells, tissues, community, ecosystemCells, tissues, organism, organelle, community, ecosystemOrganelles, cells, tissues, organism, ecosystem, community Question4 of 50What is the process by which internal conditions of an organism are maintained within acertain boundary range?AdaptationHomeostasisPhotosynthesisEvolutionMetabolism Question5 of 50A change in the body often triggers a response that counteracts the change. What kindof response is this called?positive feedback.adaptation.cause and effect.empowerment.negative feedback. Question6 of 50Which of the following best illustrates negative feedback?Food is broken down into smaller and smaller molecules.The circulatory system transports food and oxygen to body cells.Acid increases in the blood, so the kidney expels more acid from the body.During labor, contractions of the uterus get stronger and stronger.Sodium enters a neuron, triggering more and more sodium to enter. Question7 of 50What are the two main processes that ecosystems depend upon?Photosynthesis and primary productionSunlight and photosynthesis Decomposition and nutrient recyclingSpeciation and evolutionNutrient cycling and energy flow Question8 of 50Which of the following is lost from ecosystems?NitrogenMagnesiumCarbonSodiumEnergy Question9 of 50Which of the following is a producer?CatEarthwormDogHouse plantSun Question10 of 50Which of the following is true when comparing eukaryotic cells to prokaryotic cells?Eukaryotic cells are larger, but equally as complex as prokaryotic cells.Eukaryotic cells are larger and more complex than prokaryotic cells.smaller and equally complexEukarytotic cells are smaller and simpler than prokaryotic cells.Eukaryotic cells are smaller and more complex than prokaryotic cells Question11 of 50What type of cells are found in humans? prokaryoticeukaryoticplantarchaealbacterial Question12 of 50Which of these is the process by which changes occur in the characteristics oforganisms over time?EvolutionHomeostasisReproductionAdaptationMetabolism Question13 of 50Which of the following is required for natural selection to occur?OverproductionIndividual variationInheritanceUnequal reproductive successAll of the above Question14 of 50Which of the following is (are) true about null hypotheses?They are always stated in the form of a questionThey are based on theories.They are testable predictions.They are based on experimental results.All of the above. Question15 of 50Choose the answer that best describes the order of the scientific method.Observation, experiment, conclusion, hypothesisObservation, hypothesis, experiment, conclusionGuess, hypothesis, experiment, conclusionExperiment, observation, hypothesis, conclusionHypothesis, experiment, conclusion, observation. Question16 of 50In a scientific experiment, what is the purpose of the control group?is subjected to the factor whose effect is being testedserves to increase the sample size of the experimentallows for the simultaneous testing of multiple variablesis required for the validity of discovery scienceserves as a basis of comparison with the experimental group Question17 of 50Four of the five terms listed below are associated with the scientific method. Selectthe exception.FalsifiableExperimentAbsolute ProofHypothesisPrediction Question18 of 50Which of true regarding an atom with a positive charge?It possess more neutrons than protonsIt possessess equal numbers of protons, electrons, and neutronsIt possessess more protons than neutrons It possess more protons than electronsIt possess more electrons than protons Question19 of 50What is the maximum number of atoms the second electron shell can hold?16832 Question20 of 50Name the type of bond that forms between oppositely charged ions.covalentionicelectronichydrogenpolar Question21 of 50Adjacent water molecules are joined by which of the following types of ______ bonds?covalent onlyionichydrogentrivalentpolar and covalent Question22 of 50How many oxygen atoms are in the products of the following reaction? C6H12O6 + 6 H2O + 6 O2 ? 6 CO2 + 12 H2O24186122 Question23 of 50Which of the following contributes to the unique properties of water?Water molecules are very small. Water molecules tend to stick together due to cohesion.Water molecules are in constant motion.Water molecules are extremely large.Water molecules repel each other. Question24 of 50The lower the pH of a solution, the ______.more basic the solutionmore acidic the solutiongreater the number of oxygen atomshigher the OH— concentrationless toxic the solution Question25 of 50What type of molecule is the molecule seen below?CH3—CH2—CH2—CH2sugarlipidproteinnucleic acid hydrocarbon Question26 of 50What is the maximum number of covalent bonds that a single carbon atom can form?120; carbon only participates in ionic bonds.43 Question27 of 50Which of the following reaction is the reverse of a dehydration reaction?diffusionosmosishydrationdenaturationhydrolysis Question28 of 50Which of the following make up a carbohydrate?a 5-carbon ringC, H, and O atomsan NH2 groupa PO4 groupamnio acids Question29 of 50Which of the following is an example of a polysaccharide?Starch SucroseGlucoseMaltoseFructose Question30 of 50Which of the following foods contains a high proportion of saturated fats?butteravocadosskim milkolive oilcod liver oil Question31 of 50Saturated fats contain a maximum number of which of the following?oxygenphosphorushydrogencarbonnitrogen Question32 of 50What determines a protein’s function?pHsizeweightshapetemperature Question 33 of 50If one strand of a DNA double helix has the sequence AGTACTG, what is the sequenceof the second (complementary) when using base-pairing rules?TCATGACGTCATGAAGTACTGGACGTCACTACAGT Question34 of 50What type of microscope would be best for studying a stained cell on a prepared slide?stereomicroscopeTransmission electron microscopeBoth a light microscope and an electron microscopeLight microscopeScanning electron microscope Question35 of 50When using a light microscope to view a cell obtained from scraping under one’sfingernails, it is noticed that the cell lacks a nucleus. What kind of cell is this?eukaryoticanimalplantprokaryoticfungal Question36 of 50Which of the following is a function of the plasma membrane?Protein synthesisDigestion of organic materials inside the cellRegulation of the passage of material into and out of the cellControl center of the cell Lipid synthesis Question37 of 50Which of the following phrases describes the structure of the plasma membrane?fluid mosaiccellular respirationresolving powerself locomotioncell theory Question38 of 50Which of the following are responsible for giving the Rough ER it’s appearance?phospholipidschloroplastsribosomesvacuolescytosol Question39 of 50Which of the following directs cellular activities including the directions for makingproteins?plasma membranenucleusmitochondriachloroplastsgolgi apparatus Question40 of 50Which of the following is responsible for limiting the size of a cell?flagella to surface area ratio organelle to surface area ratiosurface area to volume ratiogene to nucleus ratiofood to organelle ratio Question41 of 50What is the function of lysosomes?lipid synthesiscellular respirationprotein synthesisphotosynthesisdigestion of organic matter inside the cell Question42 of 50Which of the following is found only in plant cells?plasma membranecentral vacuoleDNAribosomesnucleus Question43 of 50What do lysosomes of animal cells contain?flagellaproteinsgenesdigestive enzymeschloroplasts Question 44 of 50What is the function of a ribosome?photosynthesisDNA synthesismovement of water across the cell membranedigestionprotein synthesis Question45 of 50The figure below shows a Paramecium, a single-celled freshwater protist. The hairlikestructures visible on the Paramecium allow it to move. What are these structures called? microfilamentsmembrane proteinsintermediate filamentsciliaflagella Question46 of 50Which of the following are found only in plant cells?cell wall and central vacuoleplasma membranenucleus and contractile vacuolecell wall and ribosomesnucleus and cell wall Question47 of 50Which organelle is responsible for photosynthesis?RibosomeNucleolusMitochondrionChloroplastSmooth endoplasmic reticulum Question48 of 50What occur in mitochondria of cells?cellular respirationprotein synthesisdigestionlipid synthesisDNA replication Question49 of 50Which of the following protects and maintains the shape of plant cells?nucleusmitochondriachloroplasts cell wallplasma membrane Question50 of 50What is the name for the energy law which states that energy cannot be created ordestroyed?potential energyconservation of energyentropyconservation of heatinterconversion

Our website has a team of professional writers who can help you write any of your homework. They will write your papers from scratch. We also have a team of editors just to make sure all papers are of HIGH QUALITY & PLAGIARISM FREE. To make an Order you only need to click Ask A Question and we will direct you to our Order Page at WriteDemy. Then fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.

Do you need an answer to this or any other questions?

Have an assignment?

We are here to help you

Why we are the best

  •  High quality services
  •  On time delivery
  •  Professional writers
  •  Plagiarism free essays
  •  24/7 Customer Support
  • Satisfaction guarantee

Secure Payments